Rituum is a small widget for displaying DNA nucleotide sequences in a browser, and converting to binary code and other data formats. HTML and Javascript.
Getting started
To get started include the minified javascript file
rtm.js in your header.
You need a HTML containing element for each sequence. Make an element
and the rituum will nest nicely inside of it.
var rituum = new neodna__Rituum();
rituum.init();
rituum.nest( "container" );
Each Rituum is setup with two basic
modes,
__RTM__NUCLEOTIDE and
__RTM__BINARY.
Here we set it to nucleotide anyway.
rituum.mode( __RTM__NUCLEOTIDE );
Setting the sequence
We can input our sequence quickly and draw it on the page.
rituum.set( 'CCTACATTTCCTTTATTCATATTCTTTTTATTTTCTTGCCAATTCC' );
rituum.draw( 1 );
Commands
To get the raw contents of the Rituum.
var str = rituum.blob();
To get the contents of the Rituum window
var str = rituum.window();
To get the contents of the current selection made with the mouse.
var str = rituum.selection();
Note you can set the mode by clicking on the
m. This toggles
between
__RTM__NUCLEOTIDE and
__RTM__BINARY.
Copy and paste
Although the Rituum is drawn on canvas, you can still copy and paste using a selection you make with the mouse, or by clicking on the
c button. This will copy the contents of any specific Rituum onto the clipboard.
Words
The power of the widget is being able to change the words used. Here you can add your own base language, ie. the default is ACGT and would be set like this
rituum.words( 2, 'ACGT' );
so when we click m we toggle through the modes we have added also.
rituum.words( 2, 'CGTA' );
rituum.words( 3, 'ABCDEFGH' );
rituum.words( 4, 'ABCDEFGHIJKLMNOP' );
Width
We can change the width of the widget
rituum.width( 28 );
Length
And the total length of the widget's main window
rituum.length( 64 );
Range
And we can select a range on the widget which allows us to use selected()
rituum.range( 5, 35 );
backwardmachine at Github
Hello from happy dolphin:
